Stem-loop sequence mmu-mir-450a-1

AccessionMI0001653 (change log)
Previous IDsmmu-mir-450;mmu-mir-450-1
DescriptionMus musculus miR-450a-1 stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
   --gaga     u         u     u              ugc 
5'       gauac gagcuguuu ugcga guguuccuaauaug   u
         ||||| ||||||||| ||||| ||||||||||||||   a
3'       cugug uucgauaaa acguu uacaaggguuauau   u
   acauaa     u         u     u              uaa 
Get sequence
Deep sequencing
16697 reads, 117 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR238. The sequence is unrelated to C. elegans mir-238 (MI0000313).

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 53048154-53048244 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-450a-1
mmu-mir-322chrX: 53054255-53054349 [-]
mmu-mir-503chrX: 53053984-53054054 [-]
mmu-mir-351chrX: 53053255-53053353 [-]
mmu-mir-542chrX: 53049403-53049487 [-]
mmu-mir-450a-2chrX: 53048299-53048367 [-]
mmu-mir-450a-1chrX: 53048154-53048244 [-]
mmu-mir-450bchrX: 53047997-53048078 [-]
Database links

Mature sequence mmu-miR-450a-5p

Accession MIMAT0001546
Previous IDsmmu-miR-450;mmu-miR-450a-5p;mmu-miR-450a
Sequence

18 - 

uuuugcgauguguuccuaauau

 - 39

Get sequence
Deep sequencing23598 reads, 73 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-450a-1-3p

Accession MIMAT0017182
Previous IDsmmu-miR-450a-1*
Sequence

53 - 

auugggaacauuuugcauaaau

 - 74

Get sequence
Deep sequencing4902 reads, 74 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).