Stem-loop sequence hsa-mir-450a-1

AccessionMI0001652
Previous IDshsa-mir-450;hsa-mir-450-1
Symbol HGNC:MIR450A1
DescriptionHomo sapiens miR-450a-1 stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
   --aaac     u       uuu     u              cac 
5'       gauac aaacugu   ugcga guguuccuaauaug   u
         ||||| |||||||   ||||| ||||||||||||||   a
3'       cuaug uuugaua   acguu uacaaggguuauau   u
   auauaa     u       ugu     u              aaa 
Get sequence
Deep sequencing
4248 reads, 1.75e+03 reads per million, 57 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR238. The sequence is unrelated to C. elegans mir-238 (MI0000313).

Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 134540341-134540431 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-450a-1
hsa-mir-424chrX: 134546614-134546711 [-]
hsa-mir-503chrX: 134546328-134546398 [-]
hsa-mir-542chrX: 134541341-134541437 [-]
hsa-mir-450a-2chrX: 134540508-134540607 [-]
hsa-mir-450a-1chrX: 134540341-134540431 [-]
hsa-mir-450bchrX: 134540185-134540262 [-]
Database links

Mature sequence hsa-miR-450a-5p

Accession MIMAT0001545
Previous IDshsa-miR-450;hsa-miR-450a
Sequence

18 - 

uuuugcgauguguuccuaauau

 - 39

Get sequence
Deep sequencing1308 reads, 49 experiments
Evidence experimental; array-cloned [1,3], cloned [1,4]
Validated targets
Predicted targets

Mature sequence hsa-miR-450a-1-3p

Accession MIMAT0022700
Sequence

53 - 

auugggaacauuuugcauguau

 - 74

Get sequence
Deep sequencing65 reads, 15 experiments
Evidence experimental; Illumina [5]
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).