Stem-loop sequence rno-mir-449a

AccessionMI0001650 (change log)
Previous IDsrno-mir-449
DescriptionRattus norvegicus miR-449a stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   -c             uu      -    u          ugaguau 
5'   ugugugcgauggg  ggcagu guau guuagcuggu       g
     |||||||||||||  |||||| |||| ||||||||||        
3'   auacacguuaucc  ucguca cgua caaucgacca       u
   ac             uc      a    -          cggaaaa 
Get sequence
Deep sequencing
1017 reads, 339 reads per million, 31 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr2: 44897601-44897691 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-449a
rno-mir-449cchr2: 44896066-44896164 [+]
rno-mir-449achr2: 44897601-44897691 [+]
Database links

Mature sequence rno-miR-449a-5p

Accession MIMAT0001543
Previous IDsrno-miR-449;rno-miR-449a
Sequence

16 - 

uggcaguguauuguuagcuggu

 - 37

Get sequence
Deep sequencing1017 reads, 31 experiments
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

Mature sequence rno-miR-449a-3p

Accession MIMAT0017181
Previous IDsrno-miR-449a*
Sequence

56 - 

cagcuaacaugcaacugcucuc

 - 77

Get sequence
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).