Stem-loop sequence mmu-mir-449a

AccessionMI0001649 (change log)
Previous IDsmmu-mir-449
Symbol MGI:Mir449a
DescriptionMus musculus miR-449a stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   -c      ug    cuu      -    u          uga  au 
5'   ugugug  augg   ggcagu guau guuagcuggu   gu  g
     ||||||  ||||   |||||| |||| ||||||||||   ||   
3'   acacac  uauc   ucguca cgua caaucgacca   cg  u
   ac      gu    cuc      g    -          cgg  ag 
Get sequence
Deep sequencing
17368 reads, 1.08e+03 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MI0000025).

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 113037534-113037624 [+]
sense
OTTMUST00000112400 ; Cdc20b-004; intron 2
OTTMUST00000112401 ; Cdc20b-002; intron 2
OTTMUST00000112402 ; Cdc20b-005; intron 2
OTTMUST00000112399 ; Cdc20b-001; intron 2
OTTMUST00000112403 ; Cdc20b-003; intron 2
ENSMUST00000180543 ; Cdc20b-004; intron 2
ENSMUST00000181568 ; Cdc20b-002; intron 2
ENSMUST00000109244 ; Cdc20b-005; intron 2
ENSMUST00000181117 ; Cdc20b-001; intron 2
ENSMUST00000181741 ; Cdc20b-003; intron 2
Clustered miRNAs
< 10kb from mmu-mir-449a
mmu-mir-449cchr13: 113035983-113036091 [+]
mmu-mir-449bchr13: 113037419-113037498 [+]
mmu-mir-449achr13: 113037534-113037624 [+]
Database links

Mature sequence mmu-miR-449a-5p

Accession MIMAT0001542
Previous IDsmmu-miR-449;mmu-miR-449a
Sequence

16 - 

uggcaguguauuguuagcuggu

 - 37

Get sequence
Deep sequencing17292 reads, 69 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-449a-3p

Accession MIMAT0017180
Previous IDsmmu-miR-449a*
Sequence

56 - 

cagcuaacaugcgacugcucuc

 - 77

Get sequence
Deep sequencing75 reads, 19 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).