Stem-loop sequence hsa-mir-449a

AccessionMI0001648
Previous IDshsa-mir-449
Symbol HGNC:MIR449A
DescriptionHomo sapiens miR-449a stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   -c      ug     c       -    u          ugaa   g 
5'   ugugug  augag uggcagu guau guuagcuggu    uau u
     ||||||  ||||| ||||||| |||| ||||||||||    |||  
3'   auauac  uauuc gucguca cgua caaucggcua    gua g
   ac      gu     u       a    -          --cg   a 
Get sequence
Deep sequencing
918 reads, 197 reads per million, 29 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MI0000025).

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr5: 55170532-55170622 [-]
antisense
OTTHUMT00000313798 ; IL31RA-004; intron 4
OTTHUMT00000214148 ; IL31RA-001; intron 4
OTTHUMT00000313797 ; IL31RA-003; intron 4
OTTHUMT00000313799 ; IL31RA-005; intron 5
OTTHUMT00000313796 ; IL31RA-002; intron 6
ENST00000297015 ; IL31RA-201; intron 3
ENST00000396836 ; IL31RA-004; intron 4
ENST00000447346 ; IL31RA-001; intron 4
ENST00000359040 ; IL31RA-003; intron 4
ENST00000354961 ; IL31RA-202; intron 4
ENST00000490985 ; IL31RA-005; intron 5
ENST00000396834 ; IL31RA-002; intron 6
Clustered miRNAs
< 10kb from hsa-mir-449a
hsa-mir-449cchr5: 55172262-55172353 [-]
hsa-mir-449bchr5: 55170646-55170742 [-]
hsa-mir-449achr5: 55170532-55170622 [-]
Database links

Mature sequence hsa-miR-449a

Accession MIMAT0001541
Previous IDshsa-miR-449
Sequence

16 - 

uggcaguguauuguuagcuggu

 - 37

Get sequence
Deep sequencing97 reads, 19 experiments
Evidence experimental; cloned [1-2]
Validated targets
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).