|
miRBase |
|
Stem-loop sequence hsa-mir-449a |
||||||||
| Accession | MI0001648 | |||||||
| Previous IDs | hsa-mir-449 | |||||||
| Symbol | HGNC:MIR449A | |||||||
| Description | Homo sapiens miR-449a stem-loop | |||||||
| Gene family | MIPF0000133; mir-449 | |||||||
| Stem-loop |
-c ug c - u ugaa g ugugug augag uggcagu guau guuagcuggu uau u |||||| ||||| ||||||| |||| |||||||||| ||| auauac uauuc gucguca cgua caaucggcua gua g ac gu u a - --cg a |
|||||||
| Deep sequencing |
| |||||||
| Comments |
Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MI0000025 ). |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links | ||||||||
Mature sequence hsa-miR-449a |
|
| Accession | MIMAT0001541 |
| Previous IDs | hsa-miR-449 |
| Sequence |
16 - uggcaguguauuguuagcuggu - 37 |
| Deep sequencing | 22 reads, 6 experiments |
| Evidence | experimental; cloned [1-2] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15735639
"Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
Nature. 434:338-345(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|