Stem-loop sequence hsa-mir-449a

AccessionMI0001648 (change log)
Previous IDshsa-mir-449
Symbol HGNC:MIR449A
DescriptionHomo sapiens miR-449a stem-loop
Gene family MIPF0000133; mir-449
Literature search

129 open access papers mention hsa-mir-449a
(1238 sentences)

Stem-loop
   -c      ug     c       -    u          ugaa   g 
5'   ugugug  augag uggcagu guau guuagcuggu    uau u
     ||||||  ||||| ||||||| |||| ||||||||||    |||  
3'   auauac  uauuc gucguca cgua caaucggcua    gua g
   ac      gu     u       a    -          --cg   a 
Get sequence
Deep sequencing
12845 reads, 102 reads per million, 124 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR54. The sequence is unrelated to C. elegans mir-54 (MI0000025).

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 55170532-55170622 [-]
antisense
OTTHUMT00000313798 ; IL31RA-004; intron 4
OTTHUMT00000214148 ; IL31RA-001; intron 4
OTTHUMT00000313797 ; IL31RA-003; intron 4
OTTHUMT00000313799 ; IL31RA-005; intron 5
OTTHUMT00000313796 ; IL31RA-002; intron 6
ENST00000297015 ; IL31RA-201; intron 3
ENST00000396836 ; IL31RA-004; intron 4
ENST00000447346 ; IL31RA-001; intron 4
ENST00000359040 ; IL31RA-003; intron 4
ENST00000354961 ; IL31RA-202; intron 4
ENST00000490985 ; IL31RA-005; intron 5
ENST00000396834 ; IL31RA-002; intron 6
Clustered miRNAs
< 10kb from hsa-mir-449a
hsa-mir-449cchr5: 55172262-55172353 [-]
hsa-mir-449bchr5: 55170646-55170742 [-]
hsa-mir-449achr5: 55170532-55170622 [-]
Database links

Mature sequence hsa-miR-449a

Accession MIMAT0001541
Previous IDshsa-miR-449
Sequence

16 - 

uggcaguguauuguuagcuggu

 - 37

Get sequence
Deep sequencing12735 reads, 123 experiments
Evidence experimental; cloned [1-2]
Database links
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).