Stem-loop sequence mmu-mir-365-2

AccessionMI0001645 (change log)
Symbol MGI:Mir365-2
DescriptionMus musculus miR-365-2 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   agagugaucaa g   --       a        ac   c       -----    u   u 
5'            g aca  gcaagaa aaugaggg  uuu aggggca     gcug guu c
              | |||  ||||||| ||||||||  ||| |||||||     |||| |||  
3'            c ugu  cguucuu uuauuccu  aaa uccccgu     ugac cag c
   ----gaggcua g   ga       g        aa   -       aauac    u   u 
Get sequence
Deep sequencing
17446 reads, 44 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR190. The sequence is unrelated to mammalian mir-190 (MI0000486).

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 79726400-79726511 [+]
intergenic
Database links

Mature sequence mmu-miR-365-2-5p

Accession MIMAT0017179
Previous IDsmmu-miR-365-2*
Sequence

29 - 

agggacuuucaggggcagcugug

 - 51

Get sequence
Deep sequencing7512 reads, 64 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-365-3p

Accession MIMAT0000711
Previous IDsmmu-miR-365
Sequence

68 - 

uaaugccccuaaaaauccuuau

 - 89

Get sequence
Deep sequencing19603 reads, 75 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).