Stem-loop sequence mmu-mir-429

Accession MI0001642
Symbol MGI:Mir429
Description Mus musculus miR-429 stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   cu        u -          ug       cu   u 
 cug  gauggaug c uuaccagaca  guuagau  gga g
 |||  |||||||| | ||||||||||  |||||||  |||  
 ggc  cuaccugc g aauggucugu  uaaucug  ucu c
c   ac        c u          ca       --   a 
Get sequence
Deep sequencing
23365 reads, 86 experiments
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MI0000244 ).

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr4: 156053905-156053987 [-]
sense
OTTMUST00000025771 ; Ttll10-001; intron 1
OTTMUST00000031955 ; RP23-118E21.8-001; exon 2
ENSMUST00000097731 ; Ttll10-001; intron 1
ENSMUST00000138361 ; Gm13648-001; exon 2
Clustered miRNAs
< 10kb from mmu-mir-429
mmu-mir-200b chr4: 156055681-156055750 [-]
mmu-mir-200a chr4: 156054896-156054985 [-]
mmu-mir-429 chr4: 156053905-156053987 [-]
Database links

Mature sequence mmu-miR-429-5p

Accession MIMAT0017178
Previous IDs mmu-miR-429*
Sequence

14 - 

gucuuaccagacaugguuaga

 - 34

Get sequence
Deep sequencing 33 reads, 7 experiments
Evidence experimental; Solexa [4]
Predicted targets

Mature sequence mmu-miR-429-3p

Accession MIMAT0001537
Previous IDs mmu-miR-429
Sequence

51 - 

uaauacugucugguaaugccgu

 - 72

Get sequence
Deep sequencing 23243 reads, 78 experiments
Evidence experimental; cloned [2], Solexa [3-4]
Validated targets
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).