Stem-loop sequence mmu-mir-429

AccessionMI0001642 (change log)
Symbol MGI:Mir429
DescriptionMus musculus miR-429 stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c   cu        u -          ug       cu   u 
5'  cug  gauggaug c uuaccagaca  guuagau  gga g
    |||  |||||||| | ||||||||||  |||||||  |||  
3'  ggc  cuaccugc g aauggucugu  uaaucug  ucu c
   c   ac        c u          ca       --   a 
Get sequence
Deep sequencing
37786 reads, 457 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MI0000244).

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 156053905-156053987 [-]
sense
OTTMUST00000117417 ; Ttll10-005; intron 1
OTTMUST00000025771 ; Ttll10-001; intron 1
OTTMUST00000031955 ; RP23-118E21.8-001; exon 2
ENSMUST00000184348 ; Ttll10-005; intron 1
ENSMUST00000097731 ; Ttll10-001; intron 1
ENSMUST00000138361 ; Gm13648-001; exon 2
Clustered miRNAs
< 10kb from mmu-mir-429
mmu-mir-200bchr4: 156055681-156055750 [-]
mmu-mir-200achr4: 156054896-156054985 [-]
mmu-mir-429chr4: 156053905-156053987 [-]
Database links

Mature sequence mmu-miR-429-5p

Accession MIMAT0017178
Previous IDsmmu-miR-429*
Sequence

14 - 

gucuuaccagacaugguuaga

 - 34

Get sequence
Deep sequencing38 reads, 10 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-429-3p

Accession MIMAT0001537
Previous IDsmmu-miR-429
Sequence

51 - 

uaauacugucugguaaugccgu

 - 72

Get sequence
Deep sequencing37746 reads, 75 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).