Stem-loop sequence hsa-mir-429

Accession MI0001641
Symbol HGNC:MIR429
Description Homo sapiens miR-429 stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cgc    c        -uc          ug       cugg 
   cggc gaugggcg   uuaccagaca  guuagac    c
   |||| ||||||||   ||||||||||  |||||||     
   gucg cuaccugc   aauggucugu  uaaucug    c
--c    c        caa          ca       ucuc 
Get sequence
Deep sequencing
29 reads, 12 experiments
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MI0000244 ).

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 1104385-1104467 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-429
hsa-mir-200b chr1: 1102484-1102578 [+]
hsa-mir-200a chr1: 1103243-1103332 [+]
hsa-mir-429 chr1: 1104385-1104467 [+]
Database links

Mature sequence hsa-miR-429

Accession MIMAT0001536
Sequence

51 - 

uaauacugucugguaaaaccgu

 - 72

Get sequence
Deep sequencing 14 reads, 5 experiments
Evidence experimental; cloned [1-4]
Validated targets
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).