Stem-loop sequence hsa-mir-429

AccessionMI0001641 (change log)
Symbol HGNC:MIR429
DescriptionHomo sapiens miR-429 stem-loop
Gene family MIPF0000019; mir-8
Literature search

194 open access papers mention hsa-mir-429
(660 sentences)

Stem-loop
   cgc    c        -uc          ug       cugg 
5'    cggc gaugggcg   uuaccagaca  guuagac    c
      |||| ||||||||   ||||||||||  |||||||     
3'    gucg cuaccugc   aauggucugu  uaaucug    c
   --c    c        caa          ca       ucuc 
Get sequence
Deep sequencing
200373 reads, 382 reads per million, 133 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MI0000244).

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 1169005-1169087 [+]
sense
OTTHUMT00000005071 ; B3GALT6-001; exon 1
ENST00000379198 ; B3GALT6-001; exon 1
Clustered miRNAs
< 10kb from hsa-mir-429
hsa-mir-200bchr1: 1167104-1167198 [+]
hsa-mir-200achr1: 1167863-1167952 [+]
hsa-mir-429chr1: 1169005-1169087 [+]
Database links

Mature sequence hsa-miR-429

Accession MIMAT0001536
Sequence

51 - 

uaauacugucugguaaaaccgu

 - 72

Get sequence
Deep sequencing200286 reads, 134 experiments
Evidence experimental; cloned [1-4]
Database links
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).