|
miRBase |
|
Stem-loop sequence cfa-mir-448 |
|||||
| Accession | MI0001640 | ||||
| Description | Canis familiaris miR-448 stem-loop | ||||
| Gene family | MIPF0000149; mir-448 | ||||
| Stem-loop |
----------- a u a g u ga au auuuu
gc gggaggu g acauccugcaua ugc gccag a cccu a
|| ||||||| | |||||||||||| ||| ||||| | ||||
cg cccucua c uguaggauguau acg ugguc u gggg u
gcuacuucacc c c c - u gg cg aauca
|
||||
| Comments |
Xie et al. [1] refer to this sequence by the internal identifier MIR64. The sequence is unrelated to C. elegans mir-64 (MI0000035 ). |
||||
| Genome context |
|
||||
Mature sequence cfa-miR-448 |
|
| Accession | MIMAT0001535 |
| Sequence |
70 - uugcauauguaggaugucccau - 91 |
| Evidence | experimental; cloned [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15735639
"Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
Nature. 434:338-345(2005).
|