Stem-loop sequence hsa-mir-448

Accession MI0001637
Symbol HGNC:MIR448
Description Homo sapiens miR-448 stem-loop
Gene family MIPF0000149; mir-448
Stem-loop 
-----------  c       u a            g   u     ga au    auu  au 
           gc gggaggu g acauccugcaua ugc gccag  a  cccu   uc  a
           || ||||||| | |||||||||||| ||| |||||  |  ||||   ||   
           cg cccucua c uguaggauguau acg ugguc  u  gggg   ag  u
acugcuucacc  a       c c            -   u     gg cg    ---  aa
Get sequence
Deep sequencing
2 reads, 2 experiments
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR64. The sequence is unrelated to C. elegans mir-64 (MI0000035 ).

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 114058017-114058127 [+]
sense
OTTHUMT00000057962 ; HTR2C-002; intron 4
OTTHUMT00000057963 ; HTR2C-003; intron 4
OTTHUMT00000057962 ; HTR2C-002; intron 4
OTTHUMT00000057963 ; HTR2C-003; intron 4
OTTHUMT00000057962 ; HTR2C-002; intron 4
OTTHUMT00000057963 ; HTR2C-003; intron 4
OTTHUMT00000057961 ; HTR2C-001; intron 5
OTTHUMT00000057961 ; HTR2C-001; intron 5
OTTHUMT00000057961 ; HTR2C-001; intron 5
ENST00000371950 ; HTR2C-003; intron 4
ENST00000276198 ; HTR2C-002; intron 4
ENST00000276198 ; HTR2C-002; intron 4
ENST00000371950 ; HTR2C-003; intron 4
ENST00000276198 ; HTR2C-002; intron 4
ENST00000371950 ; HTR2C-003; intron 4
ENST00000371951 ; HTR2C-001; intron 5
ENST00000371951 ; HTR2C-001; intron 5
ENST00000371951 ; HTR2C-001; intron 5
Database links

Mature sequence hsa-miR-448

Accession MIMAT0001532
Sequence

71 -  

uugcauauguaggaugucccau

 - 92

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; cloned [1]
Validated targets
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).