Stem-loop sequence aga-mir-92a

AccessionMI0001632 (change log)
DescriptionAnopheles gambiae miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

3 open access papers mention aga-mir-92a
(33 sentences)

Stem-loop
   -     ----         c      cu    a    a    u  u 
5'  ucagg    acuacgcgu ggccgg  caag gcaa auug gu u
    |||||    ||||||||| ||||||  |||| |||| |||| || c
3'  agucc    uggugugua ccggcc  guuc cguu uaau ca a
   a     ggaa         u      cu    a    a    -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 39181115-39181203 [+]
intergenic
Database links

Mature sequence aga-miR-92a

Accession MIMAT0001527
Sequence

51 - 

uauugcacuugucccggccuau

 - 72

Get sequence
Evidence by similarity; MI0000357