Stem-loop sequence aga-mir-8

AccessionMI0001630 (change log)
DescriptionAnopheles gambiae miR-8 stem-loop
Gene family MIPF0000019; mir-8
Literature search

5 open access papers mention aga-mir-8
(20 sentences)

Stem-loop
       guc  uu -       -   g     c      u     a 
5' gggu   ug  c acaucuu acc ggcag auuaga auguu u
   ||||   ||  | ||||||| ||| ||||| |||||| |||||  
3' cccg   gc  g uguagaa ugg cuguc uaaucu uauag c
       --a  cu c       a   a     a      u     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3L: 38943045-38943130 [+]
intergenic
Database links

Mature sequence aga-miR-8

Accession MIMAT0001525
Sequence

54 - 

uaauacugucagguaaagauguc

 - 76

Get sequence
Evidence by similarity; MI0000128