Stem-loop sequence aga-mir-317

AccessionMI0001627 (change log)
DescriptionAnopheles gambiae miR-317 stem-loop
Gene family MIPF0000144; mir-317
Literature search

3 open access papers mention aga-mir-317
(10 sentences)

Stem-loop
         u              -  --u    c     -  gcauau 
5' cgucuc gccacugggauacu cc   ugug ucgcu gu      c
   |||||| |||||||||||||| ||   |||| ||||| ||       
3' guaggg cggugacucuaugg gg   acac aguga ca      g
         c              u  ucu    a     u  aacuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 28251997-28252086 [-]
intergenic
Database links

Mature sequence aga-miR-317

Accession MIMAT0001522
Sequence

56 - 

ugaacacaucuggugguaucucagu

 - 80

Get sequence
Evidence by similarity; MI0000429