Stem-loop sequence aga-mir-281

AccessionMI0001618 (change log)
DescriptionAnopheles gambiae miR-281 stem-loop
Gene family MIPF0000087; mir-46
Literature search

5 open access papers mention aga-mir-281
(13 sentences)

Stem-loop
   --------gca       a  aaa           -ua     c      ag ga 
5'            aucgaau ug   auaaagagagc   uccgu gacagu  g  u
              ||||||| ||   |||||||||||   ||||| ||||||  |  a
3'            uagcuua ac   uauuucucucg   aggua cuguca  u  u
   cgugcaacuua       -  aug           uua     -      cu aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2L: 17362421-17362522 [-]
intergenic
Database links

Mature sequence aga-miR-281

Accession MIMAT0001513
Sequence

57 - 

ugucauggaauugcucucuuuau

 - 79

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:17933784 "Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion" Winter F, Edaye S, Huttenhofer A, Brunel C Nucleic Acids Res. 35:6953-6962(2007).