Stem-loop sequence aga-mir-277

AccessionMI0001615 (change log)
DescriptionAnopheles gambiae miR-277 stem-loop
Gene family MIPF0000156; mir-277
Literature search

3 open access papers mention aga-mir-277
(7 sentences)

Stem-loop
             -a   gu    -            ----  -g    a 
5' guuuuggggu  cgu  caga ggugcauuuaca    uc  aacu u
   ||||||||||  |||  |||| ||||||||||||    ||  |||| u
3' uaagaccuua  gca  gucu ucacguaaaugu    gg  uuga c
             ca   ug    a            uuau  ag    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 28234523-28234612 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-277
aga-mir-277chr2R: 28234523-28234612 [-]
aga-mir-34chr2R: 28232667-28232756 [-]
Database links

Mature sequence aga-miR-277

Accession MIMAT0001510
Sequence

59 - 

uaaaugcacuaucugguacgaca

 - 81

Get sequence
Evidence by similarity; MI0000360