Stem-loop sequence aga-mir-184

AccessionMI0001609 (change log)
DescriptionAnopheles gambiae miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

4 open access papers mention aga-mir-184
(14 sentences)

Stem-loop
       c     aa         -     u  -  ccg   gcu 
5' ggug acucg  cccuuauca uucuu cg cc   ugu   u
   |||| |||||  ||||||||| ||||| || ||   |||    
3' ccac ugggc  gggaauagu aagag gc gg   aca   u
       -     cc         c     -  a  uca   auc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 42632357-42632438 [+]
intergenic
Database links

Mature sequence aga-miR-184

Accession MIMAT0001504
Sequence

51 - 

uggacggagaacugauaaggg

 - 71

Get sequence
Evidence by similarity; MI0000354