Stem-loop sequence aga-mir-100

AccessionMI0001603
DescriptionAnopheles gambiae miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   --     u ug   a      g     aa      -  gcacu 
gcc  ccguc g  gaa cccgua auccg  cuugug cu     g
|||  ||||| |  ||| |||||| |||||  |||||| ||     u
cgg  ggcag u  cuu ggguau uaggc  gaacac gg     a
   uu     c gu   a      a     aa      a  ucaac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3) Overlapping transcripts
chr3R: 10274677-10274768 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-100
aga-mir-100chr3R: 10274677-10274768 [-]
aga-let-7chr3R: 10270708-10270797 [-]
aga-mir-125chr3R: 10270160-10270271 [-]

Mature sequence aga-miR-100

Accession MIMAT0001498
Sequence

15 - 

aacccguagauccgaacuugug

 - 36

Get sequence
Evidence by similarity; MI0000378