Stem-loop sequence aga-mir-1

AccessionMI0001601 (change log)
DescriptionAnopheles gambiae miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

4 open access papers mention aga-mir-1
(8 sentences)

Stem-loop
   gaagcaa    g   aa            c        a    uau   u 
5'        agcu cga  guuccaugcuuc uugcauuc auag   guu g
          |||| |||  |||||||||||| |||||||| ||||   ||| u
3'        ucgg guu  cgagguaugaag aauguaag uauc   caa a
   --cuuga    -   ag            a        g    --c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 10569154-10569251 [-]
intergenic
Database links

Mature sequence aga-miR-1

Accession MIMAT0001496
Sequence

62 - 

uggaauguaaagaaguauggag

 - 83

Get sequence
Evidence by similarity; MI0000116