Stem-loop sequence aga-bantam

AccessionMI0001599 (change log)
DescriptionAnopheles gambiae bantam stem-loop
Gene family MIPF0000153; bantam
Literature search

4 open access papers mention aga-bantam
(14 sentences)

Stem-loop
   u  g     g  a   aauc      c         uuuuc     g    a   uu 
5'  gu uggau aa ugu    acagaa cgguuuuca     gaucu acuu uuu  u
    || ||||| || |||    |||||| |||||||||     ||||| |||| |||  u
3'  ca acuua uu aca    uguuuu gucgaaagu     cuaga ugaa aaa  c
   g  -     a  a   ----      a         -uuca     g    c   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 33274498-33274608 [+]
intergenic
Database links

Mature sequence aga-bantam

Accession MIMAT0001494
Sequence

70 - 

ugagaucacuuugaaagcugauu

 - 92

Get sequence
Evidence by similarity; MI0000387