Stem-loop sequence ame-mir-317

AccessionMI0001593 (change log)
DescriptionApis mellifera miR-317 stem-loop
Gene family MIPF0000144; mir-317
Literature search

4 open access papers mention ame-mir-317
(7 sentences)

Stem-loop
                a    -      --   c         g ggg 
5' gcucucggagaac ggga gccacu  cug guucacucg u   u
   ||||||||||||| |||| ||||||  ||| ||||||||| |   a
3' cgggagucuuuug cucu uggugg  gac caagugggc a   a
                a    a      uc   a         g agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000058.5: 6935820-6935909 [+]
intergenic
Database links

Mature sequence ame-miR-317-3p

Accession MIMAT0001488
Sequence

55 - 

ugaacacagcuggugguaucucagu

 - 79

Get sequence
Evidence experimental; array [1], Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).