Stem-loop sequence ame-mir-315

AccessionMI0001592 (change log)
DescriptionApis mellifera miR-315 stem-loop
Gene family MIPF0000141; mir-315
Literature search

3 open access papers mention ame-mir-315
(4 sentences)

Stem-loop
          -a  c  u            a       uugauu 
5' gcucuuu  ug uu ugauuguugcuc gaaagcc      a
   |||||||  || || |||||||||||| |||||||       
3' ugggaaa  ac aa acuaauaacggg cuuucgg      u
          gc  u  u            -       uuauag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000055.5: 9288851-9288932 [-]
intergenic
Database links

Mature sequence ame-miR-315-5p

Accession MIMAT0001487
Sequence

12 - 

uuuugauuguugcucagaaagc

 - 33

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).