Stem-loop sequence ame-mir-2-1

AccessionMI0001589 (change log)
DescriptionApis mellifera miR-2-1 stem-loop
Gene family MIPF0000049; mir-2
Literature search

3 open access papers mention ame-mir-2-1
(8 sentences)

Stem-loop
         ugu  ac      -     -             cugau  g 
5' ggcgcg   gc  cgcuca caaag ugguugugauaug     ac a
   ||||||   ||  |||||| ||||| |||||||||||||     ||  
3' cugcgc   cg  gcgagu guuuc accgacacuauac     ug g
         -ug  gu      a     g             ----u  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000054.5: 1246924-1247012 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-2-1
ame-mir-71CM000054.5: 1245684-1245783 [+]
ame-mir-2-3CM000054.5: 1246071-1246170 [+]
ame-mir-13aCM000054.5: 1246352-1246451 [+]
ame-mir-13bCM000054.5: 1246714-1246792 [+]
ame-mir-2-1CM000054.5: 1246924-1247012 [+]
ame-mir-2bCM000054.5: 1246930-1247007 [-]
ame-mir-2-2CM000054.5: 1247873-1247956 [+]
Database links

Mature sequence ame-miR-2-3p

Accession MIMAT0001485
Sequence

54 - 

uaucacagccagcuuugaugagc

 - 76

Get sequence
Evidence experimental; RTPCR [1], Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
3
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).