Stem-loop sequence ame-mir-282

AccessionMI0001588 (change log)
DescriptionApis mellifera miR-282 stem-loop
Gene family MIPF0000150; mir-282
Stem-loop
       a    aa             cuc       u     g auau 
5' ggac gagu  cuugauuuagccu   cuaggcu ugucu u    a
   |||| ||||  |||||||||||||   ||||||| ||||| |    a
3' cuug cucg  ggacuggauugga   gauccga acaga g    a
       -    --             uaa       u     g caag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000065.5: 8474136-8474227 [-]
intergenic
Database links

Mature sequence ame-miR-282-5p

Accession MIMAT0001484
Sequence

15 - 

gauuuagccucuccuaggcuuugucugu

 - 42

Get sequence
Evidence experimental; array [1], Illumina [2-3]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).