Stem-loop sequence ame-mir-281

AccessionMI0001587 (change log)
DescriptionApis mellifera miR-281 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   cgac   --a    c c -             -ua     c      aug   au 
5'     gaa   ggcg g g cuauaaagagagc   uccau gacagu   guu  a
       |||   |||| | | |||||||||||||   ||||| ||||||   |||   
3'     cuu   ucgu c c gauguuucucucg   aggua cuguca   cag  a
   gcaa   gua    - a a             uug     -      ---   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000054.5: 22275351-22275453 [-]
intergenic
Database links

Mature sequence ame-miR-281-3p

Accession MIMAT0001483
Sequence

61 - 

ugucauggaguugcucucuuugu

 - 83

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).