Stem-loop sequence ame-mir-277

AccessionMI0001585 (change log)
DescriptionApis mellifera miR-277 stem-loop
Gene family MIPF0000156; mir-277
Literature search

3 open access papers mention ame-mir-277
(5 sentences)

Stem-loop
        uu    -c           - c         c ggcc 
5' ggcag  gggg  ucgugccagau g gcguuuaca g    c
   |||||  ||||  ||||||||||| | ||||||||| |    u
3' cuguc  cucu  agcauggucua c cguaaaugu c    g
        cu    ac           u a         - auaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000058.5: 6958025-6958108 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-277
ame-mir-277CM000058.5: 6958025-6958108 [+]
ame-mir-3730CM000058.5: 6958614-6958707 [+]
ame-mir-34CM000058.5: 6962684-6962783 [+]
Database links

Mature sequence ame-miR-277-3p

Accession MIMAT0001481
Sequence

51 - 

uaaaugcacuaucugguacgaca

 - 73

Get sequence
Evidence experimental; RTPCR [1], Illumina [2-3]

References

1
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).