Stem-loop sequence ame-mir-276

AccessionMI0001584 (change log)
DescriptionApis mellifera miR-276 stem-loop
Gene family MIPF0000124; mir-276
Literature search

5 open access papers mention ame-mir-276
(6 sentences)

Stem-loop
   u    g  a     c    a     ag         guagug 
5'  ggua ag uccag agcg gguau  aguuccuac      u
    |||| || ||||| |||| |||||  |||||||||       
3'  ccgu uc agguu ucgu ccaua  ucaaggaug      u
   g    -  -     c    g     cu         aaagac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000063.5: 9788770-9788853 [+]
intergenic
Database links

Mature sequence ame-miR-276-3p

Accession MIMAT0001480
Sequence

52 - 

uaggaacuucauaccgugcucu

 - 73

Get sequence
Evidence experimental; RTPCR [1], Illumina [2]

References

1
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).