Stem-loop sequence ame-mir-210

AccessionMI0001581 (change log)
DescriptionApis mellifera miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

4 open access papers mention ame-mir-210
(4 sentences)

Stem-loop
   u   --     a gc        gc   -         uuaga 
5'  gga  cccua u  agcugcug  cac ugcacaaga     c
    |||  ||||| |  ||||||||  ||| |||||||||     a
3'  ccu  ggggu g  ucggcgac  gug gcguguucu     u
   a   uu     a ua        -a   u         cagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000055.5: 13831669-13831753 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-210
ame-mir-6038CM000055.5: 13825885-13825959 [+]
ame-mir-210CM000055.5: 13831669-13831753 [+]
Database links

Mature sequence ame-miR-210-3p

Accession MIMAT0001477
Sequence

51 - 

uugugcgugugacagcggcua

 - 71

Get sequence
Evidence experimental; RTPCR [1], Illumina [2-3]

References

1
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).