Stem-loop sequence ame-mir-184

AccessionMI0001580 (change log)
DescriptionApis mellifera miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

7 open access papers mention ame-mir-184
(50 sentences)

Stem-loop
   -uuc   -   aaa c         -      u       -  agaa 
5'     gug ccc   g cccuuauca uucucc guccggu gu    u
       ||| |||   | ||||||||| |||||| ||||||| ||    u
3'     cac ggg   c gggaauagu aagagg cagguca ca    g
   aaga   u   agc c         c      -       g  gauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000064.5: 1685584-1685675 [+]
intergenic
Database links

Mature sequence ame-miR-184-3p

Accession MIMAT0001476
Sequence

56 - 

uggacggagaacugauaagggc

 - 77

Get sequence
Evidence experimental; array [1], RTPCR [2], Illumina [3]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
3
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).