Stem-loop sequence ame-mir-124

Accession

MI0001577

Description

Apis mellifera miR-124 stem-loop

Gene family

MIPF0000021; mir-124

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.

Stem-loop

u    cuu            g    cc   ugccaacu 
 gcuc   gcguucacugcg gcuu  aug        u
 ||||   |||||||||||| ||||  |||         
 cgag   cguaaguggcgc cgga  uac        u
g    aac            a    -a   uuaaaacu 

Deep sequencing

754 reads, 1 experiments

Genome context

• Coordinates (Amel_4.0): Group11.31: 1118453-1118529 [+]
• Overlapping transcripts:

  intergenic

Database links

• ENTREZGENE: 732493;Mir124

Mature sequence ame-miR-124

• Accession: MIMAT0001473
• Sequence: 51 - uaaggcacgcggugaaugccaag - 73
• Deep sequencing: 723 reads, 1 experiments
• Evidence: experimental; array [1], RTPCR [1]

References

1. PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).