Stem-loop sequence ame-mir-12

AccessionMI0001576 (change log)
DescriptionApis mellifera miR-12 stem-loop
Gene family MIPF0000181; mir-12
Literature search

6 open access papers mention ame-mir-12
(8 sentences)

Stem-loop
                      u   u           ---g  a 
5' aagacaugggugugaguau aca cagguacuggu    ug u
   ||||||||||||||||||| ||| |||||||||||    || a
3' uucuguacucgcauucaua ugu guucaugacca    ac u
                      u   -           acag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000055.5: 3362974-3363056 [-]
intergenic
Clustered miRNAs
< 10kb from ame-mir-12
ame-mir-283CM000055.5: 3364239-3364338 [-]
ame-mir-3477CM000055.5: 3363469-3363567 [-]
ame-mir-12CM000055.5: 3362974-3363056 [-]
Database links

Mature sequence ame-miR-12-5p

Accession MIMAT0001472
Sequence

13 - 

ugaguauuacaucagguacuggu

 - 35

Get sequence
Evidence experimental; RTPCR [1], Illumina [2]

References

1
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).