Stem-loop sequence sbi-MIR172e

AccessionMI0001568 (change log)
DescriptionSorghum bicolor miR172e stem-loop
Gene family MIPF0000035; MIR172
Literature search

4 open access papers mention sbi-MIR172e
(30 sentences)

Stem-loop
   u g a    a   uc   a         g             -  -   -  aag   u 
5'  c g gccg cuc  ugc ggugcagca caucaagguucgc ca gca gc   cga c
    | | |||| |||  ||| ||||||||| ||||||||||||| || ||| ||   |||  
3'  g c cggc gag  acg ccacgucgu guaguucuaagug gu ugu cg   gcu g
   c g -    c   ua   a         a             u  g   g  -ga   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 14122957-14123071 [-]
intergenic
Database links

Mature sequence sbi-miR172e

Accession MIMAT0001464
Previous IDssbi-MIR172e
Sequence

76 - 

ugaaucuugaugaugcugcac

 - 96

Get sequence
Evidence by similarity; MI0001141

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).