Stem-loop sequence sbi-MIR169i

AccessionMI0001563 (change log)
DescriptionSorghum bicolor miR169i stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention sbi-MIR169i
(23 sentences)

Stem-loop
   --    g     ccc    u            u              u   cucuguuggcaauuccuccagccauggagauugcac 
5'   gaug agagc   cuuu gcuagccaagaa gacuugccuaugca gcc                                    a
     |||| |||||   |||| |||||||||||| |||||||||||||| |||                                     
3'   cuac ucucg   gaga cgaucgguucuu cuggacggguacgu cgg                                    a
   ac    -     --u    c            -              -   uguaacguagguaguagauacggcguuuuuaagugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr5: 16922857-16923025 [+]
intergenic
Database links

Mature sequence sbi-miR169i

Accession MIMAT0001459
Previous IDssbi-MIR169i
Sequence

21 - 

uagccaagaaugacuugccua

 - 41

Get sequence
Evidence by similarity; MI0001130

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).