Stem-loop sequence sbi-MIR169g

AccessionMI0001561 (change log)
DescriptionSorghum bicolor miR169g stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention sbi-MIR169g
(23 sentences)

Stem-loop
   gc        u      a   -         u    u       gccucuuggcuuggcuugagagcuuauuaacuc 
5'   gauaagag cugccc gau agccaagga gacu gccugug                                 u
     |||||||| |||||| ||| ||||||||| |||| |||||||                                 g
3'   cuauucuc ggcggg cug ucgguuccu cuga cggacac                                 u
   -u        -      c   a         -    -       uagcuccgguguucuucucguuuaauuugcacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 64546373-64546524 [+]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR169g
sbi-MIR169fchr2: 64543540-64543687 [+]
sbi-MIR169gchr2: 64546373-64546524 [+]
Database links

Mature sequence sbi-miR169g

Accession MIMAT0001457
Previous IDssbi-MIR169g
Sequence

21 - 

uagccaaggaugacuugccug

 - 41

Get sequence
Evidence by similarity; MI0000984

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).