Stem-loop sequence sbi-MIR169d

AccessionMI0001558 (change log)
DescriptionSorghum bicolor miR169d stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention sbi-MIR169d
(28 sentences)

Stem-loop
   -ga        -      g    -gu          ugc   u   -        a     u       uggcauugcgaguuccgguu 
5'    agaagagg ggccuu caug   ggcgagagcc   cuu ggu agccaagg ugacu gccuaca                    g
      |||||||| |||||| ||||   ||||||||||   ||| ||| |||||||| ||||| |||||||                     
3'    ucuucuuc ccggaa guac   ccguucucgg   gag ccg ucgguucc acugg cgggugu                    c
   cug        u      g    ugu          --u   u   a        -     -       uugagucgacuugaccggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 39811386-39811557 [+]
intergenic
Database links

Mature sequence sbi-miR169d-5p

Accession MIMAT0001454
Previous IDssbi-MIR169d
Sequence

43 - 

uagccaaggaugacuugccu

 - 62

Get sequence
Evidence not experimental

Mature sequence sbi-miR169d-3p

Accession MIMAT0026431
Sequence

111 - 

gggcggucaccuuggcuagc

 - 130

Get sequence
Evidence not experimental

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).