Stem-loop sequence sbi-MIR169c

AccessionMI0001557 (change log)
DescriptionSorghum bicolor miR169c stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention sbi-MIR169c
(25 sentences)

Stem-loop
   -u          ugc   u   -        a     u       cggccuugcgaguuccgguu 
5'   ggcgagagcc   cuu ggu agccaagg ugacu gccuaca                    g
     ||||||||||   ||| ||| |||||||| ||||| |||||||                     
3'   ccguucucgg   gag ccg ucgguucc acugg cgggugu                    c
   gu          --u   u   a        -     -       uuggguugacuugaccggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 39850630-39850755 [+]
intergenic
Database links

Mature sequence sbi-miR169c

Accession MIMAT0001453
Previous IDssbi-MIR169c
Sequence

21 - 

uagccaaggaugacuugccua

 - 41

Get sequence
Evidence by similarity; MI0001123

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).