Stem-loop sequence sbi-MIR164b

AccessionMI0001549 (change log)
DescriptionSorghum bicolor miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

5 open access papers mention sbi-MIR164b
(13 sentences)

Stem-loop
   - a        c  a     c        c  g         -  u  u  - ug a 
5'  g ggggcgag aa ccgug uggagaag ag gcacgugcu cg cg cg c  c u
    | |||||||| || ||||| |||||||| || ||||||||| || || || |  |  
3'  c ccccgcuc uu gguac accucuuc uc cgugcacga gc gc gc g  g g
   a -        -  c     a        c  g         c  u  u  u gu c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 65513692-65513802 [-]
intergenic
Database links

Mature sequence sbi-miR164b

Accession MIMAT0001445
Previous IDssbi-MIR164b
Sequence

21 - 

uggagaagcagggcacgugcu

 - 41

Get sequence
Evidence by similarity; MI0001104

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).