Stem-loop sequence sbi-MIR156d

AccessionMI0001548
DescriptionSorghum bicolor miR156d stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -   -acc    gag  a          -a    -          --a   -a   cc       a 
5'  ugg    ucug   ug gugaugacag  agag agagagcaca   ccc  gca  agcgagg g
    |||    ||||   || ||||||||||  |||| ||||||||||   |||  |||  ||||||| a
3'  acc    ggac   gc cgcuacuguc  ucuc ucucucgugu   ggg  cgu  ucgcucc a
   a   cacc    --a  -          ac    g          gcc   ag   cu       g 
Get sequence
Deep sequencing
1165 reads, 845 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorbi1) Overlapping transcripts
chr_2: 62836722-62836846 [-]
intergenic
Database links

Mature sequence sbi-miR156d

Accession MIMAT0001444
Previous IDssbi-MIR156d
Sequence

21 - 

ugacagaagagagagagcaca

 - 41

Get sequence
Deep sequencing994 reads, 3 experiments
Evidence by similarity; MI0001090

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).