Stem-loop sequence sbi-MIR399g

AccessionMI0001547 (change log)
DescriptionSorghum bicolor miR399g stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention sbi-MIR399g
(5 sentences)

Stem-loop
   ccaga      cu  c   g u      c  c           -au    --aaugu      a 
5'      ugugca  ug auu c gggcaa uu uccuuuggcag   gcgc       gcuccg c
        ||||||  || ||| | |||||| || |||||||||||   ||||       ||||||  
3'      acacgu  ac uaa g cccguu aa aggaaaccguc   cgcg       cggggu c
   -accg      cc  u   g c      u  -           auc    ccuucuu      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr9: 55511807-55511931 [+]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR399g
sbi-MIR399cchr9: 55505804-55505933 [-]
sbi-MIR399echr9: 55507371-55507496 [+]
sbi-MIR399gchr9: 55511807-55511931 [+]
Database links

Mature sequence sbi-miR399g

Accession MIMAT0001443
Previous IDssbi-MIR399g
Sequence

86 - 

ugccaaaggaaauuugccccg

 - 106

Get sequence
Evidence by similarity; MI0001063

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).