Stem-loop sequence sbi-MIR399c

AccessionMI0001542 (change log)
DescriptionSorghum bicolor miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention sbi-MIR399c
(5 sentences)

Stem-loop
   caua   u    -au    ua       ca             agaugcaugcagcagaaugcau 
5'     ugc gagc   gaau  cagggua  ucuccuuuggcac                      a
       ||| ||||   ||||  |||||||  |||||||||||||                      u
3'     acg cucg   cuua  gucccgu  agaggaaaccgug                      a
   --ua   u    gau    gc       ua             cgagcugucaaagcguauacgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr9: 55505804-55505933 [-]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR399c
sbi-MIR399gchr9: 55511807-55511931 [+]
sbi-MIR399echr9: 55507371-55507496 [+]
sbi-MIR399cchr9: 55505804-55505933 [-]
Database links

Mature sequence sbi-miR399c

Accession MIMAT0001438
Previous IDssbi-MIR399c
Sequence

91 - 

ugccaaaggagaauugcccug

 - 111

Get sequence
Evidence by similarity; MI0001055

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).