Stem-loop sequence sbi-MIR399a

AccessionMI0001541 (change log)
DescriptionSorghum bicolor miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention sbi-MIR399a
(7 sentences)

Stem-loop
   ugccg    c       ua           gu         aaag   c  c   aa ua     -  a 
5'      gcgc ggcgaau  cggggcaguuc  cuuuggcac    gca gu cag  c  cucga ug g
        |||| |||||||  |||||||||||  |||||||||    ||| || |||  |  ||||| || g
3'      cgug ccgcuua  gucccguuaag  gaaaccgug    cgu ca guc  g  gaguu ac g
   gaaga    c       gc           ag         ----   a  a   aa uc     c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr3: 61878757-61878892 [+]
intergenic
Database links

Mature sequence sbi-miR399a

Accession MIMAT0001437
Previous IDssbi-MIR399a
Sequence

97 - 

ugccaaaggagaauugcccug

 - 117

Get sequence
Evidence by similarity; MI0001053

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).