Stem-loop sequence sbi-MIR396b

AccessionMI0001538 (change log)
DescriptionSorghum bicolor miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention sbi-MIR396b
(13 sentences)

Stem-loop
   aga      -       ga c            c         aucucuaagaggagcagcuug 
5'    uggccu ucuuugu  u uuccacagcuuu uugaacugc                     a
      |||||| |||||||  | |||||||||||| |||||||||                     a
3'    accgga agagacg  a agggugucgaaa aacuugacg                     c
   --a      g       uc a            u         uggacgaguacguccaucucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr10: 4466694-4466821 [+]
intergenic
Database links

Mature sequence sbi-miR396b

Accession MIMAT0001434
Previous IDssbi-MIR396b
Sequence

21 - 

uuccacagcuuucuugaacug

 - 41

Get sequence
Evidence by similarity; MI0001047

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).