Stem-loop sequence sbi-MIR395e

AccessionMI0001537 (change log)
DescriptionSorghum bicolor miR395e stem-loop
Gene family MIPF0000016; MIR395
Literature search

4 open access papers mention sbi-MIR395e
(30 sentences)

Stem-loop
   auua    --       ccc           g               -  a  au 
5'     gguu  ugguguc   gggaguucucu caagcacuucacgag gc cu  u
       ||||  |||||||   ||||||||||| ||||||||||||||| || ||   
3'     ccaa  accguag   uucucaagggg guuugugaaguguuu cg ga  u
   uuua    uc       ---           -               u  a  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 57228710-57228814 [-]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR395e
sbi-MIR395echr6: 57228710-57228814 [-]
sbi-MIR395dchr6: 57228519-57228621 [-]
sbi-MIR395cchr6: 57228201-57228273 [-]
sbi-MIR395fchr6: 57228009-57228130 [-]
Database links

Mature sequence sbi-miR395e

Accession MIMAT0001433
Previous IDssbi-MIR395e
Sequence

66 - 

gugaaguguuugggggaacuc

 - 86

Get sequence
Evidence by similarity; MI0001036

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).