Stem-loop sequence mmu-mir-434

AccessionMI0001526 (change log)
Symbol MGI:Mir434
DescriptionMus musculus miR-434 stem-loop
Gene family MIPF0000439; mir-434
Stem-loop
   ucgacucug           -a  c    c c      ug      uacu 
5'          gguuugaacca  ag ucga u augguu  aaccau    u
            |||||||||||  || |||| | ||||||  ||||||     
3'          ccaagcuuggu  uc agcu a uaccaa  uuggug    a
   ------cua           cc  -    c c      gu      cuua 
Get sequence
Deep sequencing
117716 reads, 1.07e+03 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109594506-109594599 [+]
antisense
ENSMUST00000149046 ; Rtl1-201; exon 2
Clustered miRNAs
< 10kb from mmu-mir-434
mmu-mir-337chr12: 109585789-109585885 [+]
mmu-mir-3544chr12: 109585813-109585873 [-]
mmu-mir-540chr12: 109586080-109586146 [+]
mmu-mir-665chr12: 109586314-109586407 [+]
mmu-mir-3070-1chr12: 109587943-109588031 [+]
mmu-mir-3070-2chr12: 109588592-109588680 [+]
mmu-mir-431chr12: 109590447-109590537 [+]
mmu-mir-433chr12: 109591715-109591838 [+]
mmu-mir-127chr12: 109592846-109592915 [+]
mmu-mir-434chr12: 109594506-109594599 [+]
mmu-mir-432chr12: 109594956-109595030 [+]
mmu-mir-3071chr12: 109595318-109595397 [-]
mmu-mir-136chr12: 109595327-109595388 [+]
Database links

Mature sequence mmu-miR-434-5p

Accession MIMAT0001421
Sequence

23 - 

gcucgacucaugguuugaacca

 - 44

Get sequence
Deep sequencing32752 reads, 50 experiments
Evidence experimental; PCR [1], cloned [2-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-434-3p

Accession MIMAT0001422
Sequence

60 - 

uuugaaccaucacucgacuccu

 - 81

Get sequence
Deep sequencing84926 reads, 64 experiments
Evidence experimental; PCR [1], cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:15854907 "RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus" Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C Curr Biol. 15:743-749(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).