Stem-loop sequence mmu-mir-433

AccessionMI0001525 (change log)
Symbol MGI:Mir433
DescriptionMus musculus miR-433 stem-loop
Gene family MIPF0000177; mir-433
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-433. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, mir-433 is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. They play roles in development, metabolism and carcinogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ------------------------ugcccgg      gua   u           u   --------  g     cu 
5'                                ggagaa   cgg gagccugucau auu        ca agagg  a
                                  ||||||   ||| ||||||||||| |||        || |||||   
3'                                ccucuu   gcu cucggguagua uag        gu ucucc  g
   cccgacggaaguaccacaccacggcgaugga      gug   c           c   gaagaguu  g     ua 
Get sequence
Deep sequencing
68129 reads, 280 reads per million, 69 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109591715-109591838 [+]
antisense
ENSMUST00000149046 ; Rtl1-201; exon 2
Clustered miRNAs
< 10kb from mmu-mir-433
mmu-mir-337chr12: 109585789-109585885 [+]
mmu-mir-3544chr12: 109585813-109585873 [-]
mmu-mir-540chr12: 109586080-109586146 [+]
mmu-mir-665chr12: 109586314-109586407 [+]
mmu-mir-3070-1chr12: 109587943-109588031 [+]
mmu-mir-3070-2chr12: 109588592-109588680 [+]
mmu-mir-431chr12: 109590447-109590537 [+]
mmu-mir-433chr12: 109591715-109591838 [+]
mmu-mir-127chr12: 109592846-109592915 [+]
mmu-mir-434chr12: 109594506-109594599 [+]
mmu-mir-432chr12: 109594956-109595030 [+]
mmu-mir-3071chr12: 109595318-109595397 [-]
mmu-mir-136chr12: 109595327-109595388 [+]
Database links

Mature sequence mmu-miR-433-5p

Accession MIMAT0001419
Previous IDsmmu-miR-433-5p;mmu-miR-433*
Sequence

15 - 

uacggugagccugucauuauuc

 - 36

Get sequence
Deep sequencing1583 reads, 34 experiments
Evidence experimental; PCR [1], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-433-3p

Accession MIMAT0001420
Previous IDsmmu-miR-433-3p;mmu-miR-433
Sequence

67 - 

aucaugaugggcuccucggugu

 - 88

Get sequence
Deep sequencing66535 reads, 69 experiments
Evidence experimental; PCR [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:15854907 "RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus" Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C Curr Biol. 15:743-749(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).