Stem-loop sequence mmu-mir-431

AccessionMI0001524 (change log)
Symbol MGI:Mir431
DescriptionMus musculus miR-431 stem-loop
Gene family MIPF0000142; mir-431
Stem-loop
   -----    c       u          c  u a     ----   aca 
5'      cguc ugcgagg gucuugcagg cg c ugcag    gcc   c
        |||| ||||||| |||||||||| || | |||||    |||    
3'      gcag acgcucu cgggacguuc gc g acguu    ugg   u
   cuaca    a       u          u  u g     gcaa   cag 
Get sequence
Deep sequencing
56674 reads, 1.08e+03 reads per million, 41 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109590447-109590537 [+]
antisense
ENSMUST00000149046 ; Rtl1-201; exon 2
Clustered miRNAs
< 10kb from mmu-mir-431
mmu-mir-337chr12: 109585789-109585885 [+]
mmu-mir-3544chr12: 109585813-109585873 [-]
mmu-mir-540chr12: 109586080-109586146 [+]
mmu-mir-665chr12: 109586314-109586407 [+]
mmu-mir-3070-1chr12: 109587943-109588031 [+]
mmu-mir-3070-2chr12: 109588592-109588680 [+]
mmu-mir-431chr12: 109590447-109590537 [+]
mmu-mir-433chr12: 109591715-109591838 [+]
mmu-mir-127chr12: 109592846-109592915 [+]
mmu-mir-434chr12: 109594506-109594599 [+]
mmu-mir-432chr12: 109594956-109595030 [+]
mmu-mir-3071chr12: 109595318-109595397 [-]
mmu-mir-136chr12: 109595327-109595388 [+]
Database links

Mature sequence mmu-miR-431-5p

Accession MIMAT0001418
Previous IDsmmu-miR-431
Sequence

13 - 

ugucuugcaggccgucaugca

 - 33

Get sequence
Deep sequencing54160 reads, 41 experiments
Evidence experimental; PCR [1], cloned [2-3], insitu [2], Northern [2], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-431-3p

Accession MIMAT0004753
Previous IDsmmu-miR-431*
Sequence

56 - 

caggucgucuugcagggcuucu

 - 77

Get sequence
Deep sequencing2510 reads, 35 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:15854907 "RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus" Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C Curr Biol. 15:743-749(2005).
2
PMID:16566924 "Identification of new central nervous system specific mouse microRNAs" Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T FEBS Lett. 580:2195-2200(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).