Stem-loop sequence oar-mir-136

AccessionMI0001523 (change log)
DescriptionOvis aries miR-136 stem-loop
Gene family MIPF0000099; mir-136
Literature search

6 open access papers mention oar-mir-136
(9 sentences)

Stem-loop
   ucg   -        g        c     uuu          uuc 
5'    gau gagcccuc gaggacuc auuug   ugaugaugga   u
      ||| |||||||| |||||||| |||||   ||||||||||   u
3'    cua cuugggag cuucugag uaaac   gcuacuaccu   a
   -ua   u        a        -     ucu          cgc 
Get sequence
Deep sequencing
15757 reads, 1.23e+04 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64386976-64387067 [+]
antisense
ENSOART00000015109 ; oar-mir-136-201; exon 1
Clustered miRNAs
< 10kb from oar-mir-136
oar-mir-665chr18: 64379046-64379140 [+]
oar-mir-431chr18: 64383338-64383428 [+]
oar-mir-433chr18: 64384195-64384308 [+]
oar-mir-127chr18: 64385295-64385408 [+]
oar-mir-432chr18: 64386792-64386881 [+]
oar-mir-136chr18: 64386976-64387067 [+]
Database links

Mature sequence oar-miR-136

Accession MIMAT0001417
Sequence

20 - 

acuccauuuguuuugaugaugga

 - 42

Get sequence
Deep sequencing14733 reads, 14 experiments
Evidence experimental; PCR [1]

References

1
PMID:15854907 "RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus" Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C Curr Biol. 15:743-749(2005).