Stem-loop sequence oar-mir-432

AccessionMI0001522 (change log)
DescriptionOvis aries miR-432 stem-loop
Gene family MIPF0000211; mir-432
Literature search

6 open access papers mention oar-mir-432
(28 sentences)

Stem-loop
   gcaugacuccu     u u     ua       g     a   uu   uu 
5'            ccaag c uggag  ggucauu ggugg ucc  uau  c
              ||||| | |||||  ||||||| ||||| |||  |||   
3'            gguuc g accuc  ucgguag ucacc ggg  gua  c
   ---------gc     u u     -c       g     -   -u   uc 
Get sequence
Deep sequencing
462 reads, 8.33 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64386792-64386881 [+]
antisense
ENSOART00000015109 ; oar-mir-136-201; exon 1
Clustered miRNAs
< 10kb from oar-mir-432
oar-mir-665chr18: 64379046-64379140 [+]
oar-mir-431chr18: 64383338-64383428 [+]
oar-mir-433chr18: 64384195-64384308 [+]
oar-mir-127chr18: 64385295-64385408 [+]
oar-mir-432chr18: 64386792-64386881 [+]
oar-mir-136chr18: 64386976-64387067 [+]
Database links

Mature sequence oar-miR-432

Accession MIMAT0001416
Sequence

17 - 

ucuuggaguaggucauugggugg

 - 39

Get sequence
Deep sequencing429 reads, 12 experiments
Evidence experimental; PCR [1]

References

1
PMID:15854907 "RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus" Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C Curr Biol. 15:743-749(2005).