Stem-loop sequence oar-mir-127

AccessionMI0001521 (change log)
DescriptionOvis aries miR-127 stem-loop
Gene family MIPF0000080; mir-127
Literature search

10 open access papers mention oar-mir-127
(28 sentences)

Stem-loop
   ------------  -uu   --uc   guc   a   u   g         g  c      --  a 
5'             gc   uga    acu   ucc gcc gcu aagcucaga gg ucugau  uc g
               ||   |||    |||   ||| ||| ||| ||||||||| || ||||||  || a
3'             cg   acu    uga   agg ugg cgg uucgagucu cc aggcua  ag a
   uugggcuuccuu  ucu   ccuc   ---   c   u   -         g  u      cu  a 
Get sequence
Deep sequencing
5745 reads, 623 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr18: 64385295-64385408 [+]
antisense
ENSOART00000015109 ; oar-mir-136-201; exon 1
Clustered miRNAs
< 10kb from oar-mir-127
oar-mir-665chr18: 64379046-64379140 [+]
oar-mir-431chr18: 64383338-64383428 [+]
oar-mir-433chr18: 64384195-64384308 [+]
oar-mir-127chr18: 64385295-64385408 [+]
oar-mir-432chr18: 64386792-64386881 [+]
oar-mir-136chr18: 64386976-64387067 [+]
Database links

Mature sequence oar-miR-127

Accession MIMAT0001415
Sequence

58 - 

aucggauccgucugagcuuggcu

 - 80

Get sequence
Deep sequencing4428 reads, 13 experiments
Evidence experimental; PCR [1]

References

1
PMID:15854907 "RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus" Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C Curr Biol. 15:743-749(2005).