Stem-loop sequence hsa-mir-20b

Accession

MI0001519

Symbol

HGNC:MIR20B

Description

Homo sapiens miR-20b stem-loop

Gene family

MIPF0000001; mir-17

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Stem-loop

     -ca           g     -gu    uu 
aguac   aagugcucaua ugcag   aguu  g
|||||   ||||||||||| |||||   ||||  g
ucaug   uucacggguau auguc   ucag  c
     acc           g     auc    ua 

Deep sequencing

5170 reads, 25 experiments

Genome context

• Coordinates (GRCh37.p5): chrX: 133303839-133303907 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-20b

• hsa-mir-106a: chrX: 133304228-133304308 [-]
• hsa-mir-18b: chrX: 133304071-133304141 [-]
• hsa-mir-20b: chrX: 133303839-133303907 [-]
• hsa-mir-19b-2: chrX: 133303701-133303796 [-]
• hsa-mir-92a-2: chrX: 133303568-133303642 [-]
• hsa-mir-363: chrX: 133303408-133303482 [-]

Database links

• EMBL: AY785943;AY785943
• ENTREZGENE: 574032;MIR20B
• HGNC: 32024;MIR20B

Mature sequence hsa-miR-20b-5p

• Accession: MIMAT0001413
• Previous IDs: hsa-miR-20b
• Sequence: 6 - caaagugcucauagugcagguag - 28
• Deep sequencing: 3381 reads, 24 experiments
• Evidence: experimental; array-cloned [2], cloned [3-5]
• Validated targets:
  • TARBASE:hsa-miR-20b-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-20b-5p
  • MICRORNA.ORG:hsa-miR-20b-5p
  • MIRDB:hsa-miR-20b-5p
  • RNA22-HSA:hsa-miR-20b-5p
  • TARGETMINER:hsa-miR-20b-5p
  • TARGETSCAN-VERT:hsa-miR-20b

Mature sequence hsa-miR-20b-3p

• Accession: MIMAT0004752
• Previous IDs: hsa-miR-20b*
• Sequence: 44 - acuguaguaugggcacuuccag - 65
• Deep sequencing: 1789 reads, 9 experiments
• Evidence: experimental; cloned [4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-20b-3p
  • MICRORNA.ORG:hsa-miR-20b-3p
  • MIRDB:hsa-miR-20b-3p
  • RNA22-HSA:hsa-miR-20b-3p
  • TARGETMINER:hsa-miR-20b-3p

References

1. PMID:15944709 "c-Myc-regulated microRNAs modulate E2F1 expression" O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT Nature. 435:839-843(2005).
2. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).