Stem-loop sequence hsa-mir-20b

AccessionMI0001519 (change log)
Symbol HGNC:MIR20B
DescriptionHomo sapiens miR-20b stem-loop
Gene family MIPF0000001; mir-17
Literature search

208 open access papers mention hsa-mir-20b
(656 sentences)

Stem-loop
        -ca           g     -gu    uu 
5' aguac   aagugcucaua ugcag   aguu  g
   |||||   ||||||||||| |||||   ||||  g
3' ucaug   uucacggguau auguc   ucag  c
        acc           g     auc    ua 
Get sequence
Deep sequencing
204119 reads, 545 reads per million, 150 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 134169809-134169877 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-20b
hsa-mir-106achrX: 134170198-134170278 [-]
hsa-mir-18bchrX: 134170041-134170111 [-]
hsa-mir-20bchrX: 134169809-134169877 [-]
hsa-mir-19b-2chrX: 134169671-134169766 [-]
hsa-mir-92a-2chrX: 134169538-134169612 [-]
hsa-mir-363chrX: 134169378-134169452 [-]
Database links

Mature sequence hsa-miR-20b-5p

Accession MIMAT0001413
Previous IDshsa-miR-20b
Sequence

6 - 

caaagugcucauagugcagguag

 - 28

Get sequence
Deep sequencing196940 reads, 151 experiments
Evidence experimental; array-cloned [2], cloned [3-5]
Database links
Predicted targets

Mature sequence hsa-miR-20b-3p

Accession MIMAT0004752
Previous IDshsa-miR-20b*
Sequence

44 - 

acuguaguaugggcacuuccag

 - 65

Get sequence
Deep sequencing7174 reads, 110 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

References

1
PMID:15944709 "c-Myc-regulated microRNAs modulate E2F1 expression" O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT Nature. 435:839-843(2005).
2
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).