Stem-loop sequence hsa-mir-18b

Accession MI0001518
Symbol HGNC:MIR18B
Description Homo sapiens miR-18b stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ug     --   u    c   u     ua  --g     
  uguua  agg gcau uag gcagu  gu   aagc 
  |||||  ||| |||| ||| |||||  ||   ||| a
  acggu  ucc cgua auc cguca  ua   uucg 
--     cu   c    a   c     uc  aga     
Get sequence
Deep sequencing
2600 reads, 25 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 133304071-133304141 [-]
sense
ENST00000454574 ; MIR18B-201; exon 1
Clustered miRNAs
< 10kb from hsa-mir-18b
hsa-mir-106a chrX: 133304228-133304308 [-]
hsa-mir-18b chrX: 133304071-133304141 [-]
hsa-mir-20b chrX: 133303839-133303907 [-]
hsa-mir-19b-2 chrX: 133303701-133303796 [-]
hsa-mir-92a-2 chrX: 133303568-133303642 [-]
hsa-mir-363 chrX: 133303408-133303482 [-]
Database links

Mature sequence hsa-miR-18b-5p

Accession MIMAT0001412
Previous IDs hsa-miR-18b
Sequence

6 - 

uaaggugcaucuagugcaguuag

 - 28

Get sequence
Deep sequencing 2525 reads, 25 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-18b-3p

Accession MIMAT0004751
Previous IDs hsa-miR-18b*
Sequence

49 - 

ugcccuaaaugccccuucuggc

 - 70

Get sequence
Deep sequencing 63 reads, 7 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:15944709 "c-Myc-regulated microRNAs modulate E2F1 expression" O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT Nature. 435:839-843(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).