Stem-loop sequence hsa-mir-18b

AccessionMI0001518 (change log)
Symbol HGNC:MIR18B
DescriptionHomo sapiens miR-18b stem-loop
Gene family MIPF0000001; mir-17
Literature search

106 open access papers mention hsa-mir-18b
(266 sentences)

Stem-loop
   ug     --   u    c   u     ua  --g     
5'   uguua  agg gcau uag gcagu  gu   aagc 
     |||||  ||| |||| ||| |||||  ||   ||| a
3'   acggu  ucc cgua auc cguca  ua   uucg 
   --     cu   c    a   c     uc  aga     
Get sequence
Deep sequencing
690762 reads, 2.97e+03 reads per million, 155 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 134170041-134170111 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-18b
hsa-mir-106achrX: 134170198-134170278 [-]
hsa-mir-18bchrX: 134170041-134170111 [-]
hsa-mir-20bchrX: 134169809-134169877 [-]
hsa-mir-19b-2chrX: 134169671-134169766 [-]
hsa-mir-92a-2chrX: 134169538-134169612 [-]
hsa-mir-363chrX: 134169378-134169452 [-]
Database links

Mature sequence hsa-miR-18b-5p

Accession MIMAT0001412
Previous IDshsa-miR-18b
Sequence

6 - 

uaaggugcaucuagugcaguuag

 - 28

Get sequence
Deep sequencing690346 reads, 155 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-18b-3p

Accession MIMAT0004751
Previous IDshsa-miR-18b*
Sequence

49 - 

ugcccuaaaugccccuucuggc

 - 70

Get sequence
Deep sequencing381 reads, 76 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15944709 "c-Myc-regulated microRNAs modulate E2F1 expression" O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT Nature. 435:839-843(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).